Sean the hedgehog Club
gabung
Fanpop
New Post
Explore Fanpop
Song: link

Sean The Hedgehog: *Walking down a street*
Gordon: He's hosting!
Twilight: Man I wanna be the host!!!!!
Spike: Twilight, calm down!
Twilight: *Shoots Spike, and fires at Sean*
Sean The Hedgehog: *Runs as he dodges the bullets*
Gordon: He's getting away!!!
Sean The Hedgehog: So long ponies! *Stops running as he reaches a train track* And now we wait for the other Sean.
Sean: *Blows his horn twice as he arrives*
Sean The Hedgehog: Hi, I'm Sean.
Sean: And I'm Sean. We're hosting this week's segment of Sean's Spectacular Saturday of Stories.
Sean The Hedgehog: But we're not the Sean's responsible for menulis this stuff.
Sean: All the same we hope anda like it. Up first, back to back episodes of..

On The Block - Rated TV-PG13

Sean The Hedgehog: And then..

My Little Pornstar: Rated TV-MA
Adventures of Thomas & Friends: Rated TV-Y7

Sean: Enjoy.

Welcome to the block, where a group of ponies that are friends live on the same block in Ponyville. And now for your hosts, Master Sword, and Tom Foolery.

Audience: *Cheering*
Master Sword & Tom: *Standing in front of a house*
Master Sword: hey everypony.
Audience: *Clapping*
Tom: Remember in the sebelumnya episode how anda berkata we might get killed oleh assassins working for Warner Brothers?
Audience: *Laughing*
Master Sword: Yes.
Tom: Well that happened to me.
Master Sword: Okay. How are anda still alive?
Tom: Now wait a minute. Did I say that I died? No! anda have to listen man.
Audience: *Laughing*
Master Sword: *Confused* Weird, but whatever. Today's crossover parody is The Derpy Files.
Tom: Featuring Derpy taking Jim Rockford's role in the T.V show, The Rockford Files. Be prepared for some strange pertanyaan if anda get caught, atau arrested.
Audience: *Laughing*

Somewhere at Derpy's trailer home, a phone starts to ring, and it goes to voicemail.

Derpy: This is Derpy Hooves. At the tone, leave your name, and message. I'll get back to you.
Unknown Pony: How in the world did anda become a detective? You're too retarded, your eyesight is bad, and the only thing anda give a damn about are muffins!

The Derpy Files

Starring Derpy Hooves as herself
Heartsong as Suzanne Hooves
Saten Twist as Tom Selleck
Mortomis as Officer McManis
Sophie Shimmer as Bail O' Cotton

Derpy was in the middle of chasing Bail O' Cotton. She was responsible for kidnapping a famous pony.

Bail: *Driving on a bridge*
Derpy: *Following Bail*

The green screen behind Derpy's car made it look like she was going forward, then backwards.

Audience: *Laughing*
Bail: *Drifts left*
Derpy: *Goes left*
Bail: She's catching up. I must go faster!

The green screen behind Bail's car made it look like she was going slower.

Audience: *Laughing*
Derpy: *About to ram the back of Bail's car*
Bail: *Goes right*
Derpy: *Looking at green screen* Why is it making me go sideways?
Audience: *Laughing*
Derpy: Okay, cut!
TV Ponies: *Turning off equipment, and turning lights on*
Derpy: Something is wrong with the green screen.
Bail: You're crosseyed! How did anda figure that out?
Audience: *Laughing*
Derpy: I just did.
Tom: Hey! Can someone let me out of this car's trunk? Its smells like rotten ikan in here.
Derpy: Um, sorry. We're still producing here! anda gotta wait another five minutes.
Audience: *Laughing*
Tom: No I don't. I heard anda talking about the green screen not working, and now we're not doing anything. Let me out!
Bail: No.
Tom: And I thought I got bad abuse in Celebrity Jeopardy.
Audience: *Laughing*

Derpy got to her house when she saw a police car.

Derpy: *Confused* Either my eyesight is getting better, atau I'm just a crazy idiot.
Audience: *Laughing*
Derpy: *Opens door to house* Mom?
Suzanne: In here Sweetheart.
Derpy: *Arrives* What are anda doing with the police?
Officer McManis: I'm sorry ma'am, but your mother has been accused of murder. I'm taking her downtown.
Derpy: Oh! I like downtown. Can I come with you?
Audience: *Laughing*
Suzanne: Not that downtown Derpy!
Derpy: hey wait a minute. I'm a detective! I can prove that my mom has been framed, because she would never murder anypony.
Suzanne: Forget it.
Derpy: *Forgot about what her mom just said* Forget about what?
Audience: *Laughing*

Theme Song: link

Master Sword: Come on Tom, let's go meet the others.
Tom: Right behind you.
Double Scoop: *Standing on jalan, street corner*
Aina: *Runs out of her house*
Sunny: Hey, wait for me. *Flying in the middle of the street*
Saten Twist: *Polishing his chain saw, but stops to go meet the others*
Pleiades: *Arrives at corner*
Mortomis: *Standing selanjutnya to Double Scoop*
Tom: lebih ponies!!
Snow Wonder: *Arrives in a brand new Corvette*
Cosmic Rainbow: *Flies from the clouds*
Heartsong: *Climbs out of a manhole*
Annie: *Arrives on a bicycle*
Blaze: *Flies out of a house window, and lands selanjutnya to Tom*
Sophie Shimmer: *Gets off of a slow moving bus*
Astrel Sky: *Appears out of nowhere with magic*
All: We live together on the block!
Audience: *Clapping*
Announcer: Okay, stop the song! We need to keep this thing rolling.
Audience: *Laughing*

Episode 4: Tom, Tom, and Tom

Announcer: On The Block was filmed in front of a live audience.
Audience: *Laughing*
Announcer: This joke is getting old. Why are anda still laughing at it?
Audience: *Laughing*

Tom was watching TV with Mortomis.

Tom: So what was this tampil anda wanted to tampil me?
Mortomis: This tampil I wanted to tampil anda is a tampil that shows anda a dragon named Albi, and he's actually part of a kid's tampil that my little brother wanted me to watch, so I'm going to watch it here, and if I like it, I'll watch it with him.
Audience: *Laughing*
Tom: Is that all Mort?
Audience: *Laughing*
Mortomis: I think so, yeah.
TV Announcer: We hope anda enjoyed the My Little Human special, American Mares.
Audience: *Laughing*
Tv Announcer: Up selanjutnya is a new episode of Albi The Racist Dragon.
Audience: *Laughing*
Tom: This is supposed to be a kid's show?

The theme song starts for the show.

Singer: In the selai jeruk, selai forest.
Singer 2: Forest.
Singer: Between the make believe trees. In a cottage cheese cottage.
Audience: *Laughing*
Singer: Lives Albi.
Singers: Albi.
Singer: Albi.
Singers: Albi. Albi, the racist dragon.
Audience: *Laughing*
Narrator: Chapter 6. And so, all the villagers chased Albi the racist dragon into a very cold, and very scary cave. It was so dark, and scary there, that Albi began to cry. Dragon tears, which as we all know, turn into jeli beans.
Audience: *Laughing*
Narrator: Just then, he felt a tiny hoof on his tail. He turned around, and who should it be? But the badly burned albanian kuda jantan muda, colt from the hari before.
Audience: *Laughing*
Albi: What are anda doing here? I thought I killed anda yesterday.
Narrator: Grumbled Albi, quite racistly.
Audience: *Laughing*
Albanian Colt: No. No Albi. anda didn't kill me with your dragon flames. I crawled to safety, but I was left very badly disfigured.
Audience: *Laughing*
Narrator: Laughed the boy.
Audience: We laughed too!
Albanian Colt: Why are anda crying Albi?
Albi: Well, all the villagers chased me into this scary cave. I think it's because I'm so racist. Get your hoof off my tail, you'll make it dirty.
Audience: *Laughing*
Albanian Colt: They didn't chase anda hear because of your racism. They chased me here too, and I became all disfigured like this. They just don't like us. Because we're different to them.
Narrator: And at that, Albi cried a single tear that turned into a jeli bean, it had all the warna of the rainbow, and suddenly, Albi wasn't racist anymore.
Singer: So they sat in the cave.
Singer 2: The cave.
Singer: And ate bubblegum pie.
Singers: Yum.
Singer: Albi, the racist.
Albanian Colt: Albi, the racist.
Singer: Albi, the racist..
Albi: Well, not anymore.
Singers: Dragon!

The tampil ends, and Mortomis has a tear come out of his eye.

Audience: *Laughing*
Tom: *Also has a tear come out of his eye* You're crying over a kid's show.
Mortomis: Yeah, so are you.
Audience: *Laughing*

Coming up in the selanjutnya part is Celebrity Jeopardy.

Our cast for this skit is

Saten Twist - Alex Trebek (He wears a white wig, and his cutie mark has been changed to a game tampil wheel.)
Sean the hedgehog as himself (He's a famous war hero.)
Double Scoop As Adam Sandler
and Blaze as Tom Cruise

Audience: *Clapping*
Alex: Welcome back to Celebrity Jeopardy. Once again, I'm going to recommend that our viewers watch something else.
Audience: *Laughing*
Alex: That said, let's take a look at the score. Sean the hedgehog is in first place with zero.
Audience: *Laughing, and clapping*
Sean: You'll rue the hari anda crossed me Trebek.
Audience: *Laughing*
Alex: Fantastic. Adam Sandler is in detik place with negative six thousand dollars.
Audience: *Cheering*
Adam: Hi. How anda doing out there Alex? *Excited* Time for da Jeopardy! *Speaks like a german* I cinta it. Your father loves it. Your Aunt Helen watches every episode on Blu Ray.
Alex: Fantastic. And finally, Tom Cruise is in third with an incredible negative twelve thousand dollars.
Audience: *Cheering*
Alex: The negative twelve thousand dollars is from incorrectly answering a number of first round pertanyaan lebih than once.
Audience: *Laughing*
Tom: Hey, uh- It's really great to be here Alex. *Points to Adam* Who's this guy? I cinta this guy. He's got the great sound effects. Also, it's a pleasure to be working with Sean the hedgehog.
Sean: *Salutes to Tom*
Alex: Right. Better luck to all of anda in the selanjutnya round. It's time for Double Jeopardy. Let's take a look at the board. The categories are.

Potent Potables
The Vowels
Presidents Who Are On The One Dollar Bill
Famous Titles
Human Children
The Number 4
And finally, Foods Beginning With Spaghett.

Audience: *Laughing*
Alex: Tom Cruise, anda are in third, so the board is yours.
Tom: I uh, hehehehe.
Audience: *Laughing*
Tom: I uh, hehehehe. I uh, hehehehe.
Alex: Mr. Sandler, why don't anda pick?
Adam: *Angry* Once again, something that could've been brought to my ATTENTION YESTERDAY!
Audience: *Laughing*
Alex: Mr. The Hedgehog, go ahead.
Sean: The hari is mine!
Audience: *Laughing*
Sean: I'll take famous titties for 400.
Audience: *Laughing*
Alex: Titles. Famous Titles.
Sean: Damn!
Alex: And the answer is, this movie judul was taken from the famous book, Gone With The Wind.
Sean: *Rings buzzer*
Alex: Mr. The Hedgehog?
Sean: Olivia de Havilland!

Wrong.

Alex: Titles Mr. The Hedgehog, not titties.
Audience: *Laughing*
Sean: Not a fan of the ladies, are anda Trebek?
Audience: *Laughing*
Adam: *Rings buzzer*
Alex: Mr. Sandler?
Adam: Why are anda yelling at me?
Audience: *Laughing*
Alex: anda rang in.
Tom: *Rings buzzer*
Alex: Mr. Cruise?
Tom: Alright, I got this. It's in my head, I know it. It's right up there, I know it. I got it.

He ran out of time.

Alex: anda don't got it.
Tom: No, anda don't got it!
Audience: *Laughing*
Tom: Get it?!
Audience: *Laughing, clapping, and whistling*
Alex: The answer of course was Gone With The Wind. Gone With The Wind. Okay, Mr. The Hedgehog it's still your board, so I'll pick a category for you. The number 4 for 200. In this category, the correct response to every pertanyaan is 4. When I stop talking, just say the word, four. Okay, let's give it a shot. This is how many legs a pony has.
Tom: *Rings buzzer*
Alex: Mr. Cruise?
Tom: 2.

He was wrong.

Alex: No.
Audience: *Laughing*
Tom: Ah! *Looks at his front legs* Ah! *Looks at Sean's legs* Ah! *Looks at the ground* Ah!
Audience: *Laughing*
Adam: *Rings buzzer*
Alex: Mr. Sandler?
Adam: Okay, so there was this one time, I was on a perahu with some of my friends, and somepony was on the back, and he said, *Talks in german accent* Come to the back of the boat.
Audience: *Laughing*
Alex: Time's up. Time is up. The answer was 4, every pony has 4 legs.
Sean: I'll tampil anda a leg Trebek!
Audience: *Laughing*
Alex: Okay, Mr. Cruise, anda pick a category.
Tom: Help me Alex. anda help me, I'll help you. anda help me, I'll help you.
Audience: *Laughing*
Alex: Okay.
Tom: Alright, I'll take Famous Titties for 800.
Audience: *Cheering, and clapping*
Sean: *Speaks in british accent* Good tampil old boy.
Audience: *Laughing*
Alex: FAMOUS TITLES for 800. And it's an audio daily double. This song was this TV show's theme. Listen carefully.

Song: link

Tom: *Listening to music*
Adam: *Listening to music*
Sean: *Listening to music*
Audience: *Laughing*
Tom: *Hearing the singers say Batman*
Audience: *Laughing*
Alex: *Stops song*
Tom: I, uh...
Alex: Mr. Cruise?
Tom: What is M*A*S*H?
Audience: *Laughing*
Alex: No.
Sean: *Rings buzzer* What is After M*A*S*H?
Audience: *Laughing*
Alex: No.
Sean: The one with Jamie Farr!
Alex: Yes, I know.
Adam: *Rings buzzer*
Alex: Mr. Sandle- wait, where did anda get a guitar?
Audience: *Laughing*
Adam: *Plays guitar* Timothy Dalton, played as Con Mane. So did Pierce Brosnan. *Stops guitar* Along with Roger Moore.
Audience: *Laughing*
Alex: Okay, let's go to Final Jeopardy. The category is to answer this question. Where are anda right now?
Audience: *Laughing*
Alex: It could be Equestria, atau the planet Earth.
Audience: *Laughing*
Alex: How about the word here?
Audience: *Laughing*
Alex: atau a game show. Just write down where anda are right now.
Audience: *Laughing*
Alex: *Rings bell* Okay, let's see what anda wrote down. *Goes to Tom's podium* Okay, Mr. Cruise, anda wrote, go. I don't know what that means, but anda wagered for it. Go for it. anda certainly did.
Audience: *Laughing*
Tom: Hehehee. Hahaha! HA!
Audience: *Laughing*
Alex: *Goes to Adam* Okay. Mr. Sandler, let's see what anda wrote. Abby Dooby.
Adam: *Sounding like a child* Abby Dooby, Abbyabbyabbyabbyabby.
Audience: *Laughing*
Alex: I feel like I want to meninju, pukulan you. Moving on. *Goes to Sean* Mr. The Hedgehog, anda wrote. *Looks at screen* Good lord, anda wrote indoors.
Audience: *Laughing*
Alex: Are we recording this? Let's see what anda wagered.

What Sean wrote made Indoors look like

Alex: I jantung boobs.
Audience: *Laughing*
Alex: Great. That is all we have for Celebrity Jeopardy, I'm going to go home, and put a gun in my mouth. Goodnight.
Audience: *Laughing, and clapping*

Up selanjutnya is the Story of Corporal Agarn.

The Story of Corporal Agarn

Theme song

Though he goes on a rage from time to time
He is a very good friend of mine
And in Fort Courage he is well known as
Corporal Agarn

Starring Master Sword as Corporal Agarn
Tom Foolery as Captain Parmenter
Saten Twist as Sargent O' Rourke
Mortomis as Dobbs, the bugler
Snow Wonder as Wrangler Jane
Cosmic pelangi as Corporal Vanderbilt
Blaze as Corporal Duffy

Vanderbilt was in the guard tower, when Dobbs, Duffy, and Agarn were near the cannon.

Duffy: We think something is wrong with the cannon.
Agarn: Why?
Dobbs: Everytime we try to shoot it, it never works. Then one of us kicks it, the left wheel falls off, then it shoots a meriam right into the guard tower.
Audience: *Laughing*
Agarn: How is that possible?
Audience: *Laughing*
Duffy: I don't know, but we never had that problem in the Alamo.
Agarn: Can anda talk about anything other than the Alamo?
Audience: *Laughing*
Duffy: No. Now, if you'd like, we'll tampil anda that the meriam is doing what we're telling anda it does.
Agarn: Alright, shoot it.
Duffy: *Puts cannonball into cannon*
Dobbs: *Lights fuse*

When the fuse got to the bottom, the meriam didn't go off.

Agarn: *Gets angry, and kicks the cannon. The left wheel falls off, and then it shoots the cannonball at Vanderbilt's tower*
Vanderbilt: *Jumps out of tower*
Audience: *Laughing*
Duffy: See sir? We need to fix the cannon.
Agarn: atau we could get a new cannon.
Dobbs: But Agarn-
Agarn: I'm warning anda Dobbs!
Audience: *Laughing*

Sargent O' Rourke went with Corporal Agarn to go talk to Captain Parmenter on getting a new cannon.

Parmenter: *Signing papers, but drops his pen on the floor. He starts looking for it*
Audience: *Laughing*
O' Rourke: *Arrives with Agarn* Captain, did anda lose something?
Parmenter: Nope, just trying to find my pen.
Audience: *Laughing*
Agarn: Captain, we need a new cannon.
Parmenter: What's wrong with the one we have?
Audience: *Laughing*
Agarn: We'll tampil you.

So Corporal Agarn, and Sargent O' Rourke took Captain Parmenter to see the cannon.

Dobbs: Back with reinforcements Agarn?
Agarn: What's that supposed to mean?!
Audience: *Laughing*
Sargent O' Rourke: We wanna tampil the Captain that the meriam doesn't work properly.
Agarn: Alright, shoot it.
Duffy: *Puts cannonball into cannon*
Dobbs: *Lights fuse*

When the fuse got to the bottom, the meriam didn't go off.

Agarn: *Gets angry, and kicks the cannon. The left wheel falls off, and then it shoots the cannonball at Vanderbilt's tower*
Vanderbilt: *Jumps out of tower*
Audience: *Laughing*
Captain Parmenter: Okay, we'll get a new cannon. As soon as some of the debris from that tower gets out of my quarters.
Audience: *Laughing*
Ponies: *Singing* Though he goes on a rage from time to time, he is a very good friend of mine. And in Fort Courage he is well known as, Corporal Agarn.
Dobbs: *Playing the terompet poorly*
Corporal Agarn: I'm warning anda Dobbs!
Audience: *Laughing*

Bodyshop Ponies

Starring Sophie Shimmer as Wheel Bearing
Heartsong as Dainelle DeVito
Snow Wonder as Cutlass Supreme
Tom Foolery as Gary
Mortomis as Mr. Beddler
Pleiades as zaitun
Master Sword as Tim
and Annie as Edwina

At the bodyshop, Mr. Beddler was informing everypony about a car coming into the shop.

Mr. Beddler: Okay everypony, we're supposed to have a Prius come into the shop.
Others: Boo!!!!
Audience: *Laughing*
Mr. Beddler: I know nopony likes the Prius, but this job will be very simple. All we have to do is fix this tiny dent on the hood. Get some body filler on there, make that dent go away, spray primer, get guide coat, wet sand, and repaint it.
Olive: Can anda be lebih specific than just giving us generic details on our job?
Audience: *Laughing*
Mr. Beddler: anda know what I mean!
Wheel Bearing: What is the driver of the Prius like?
Mr. Beddler: A very responsible young stallion with a wife, and a four tahun old son.

But the driver of the Prius was drunk, and was listening to disco on the car radio.

Audience: *Laughing*
Drunk Pony: *Gets the side of his car to scrape against a guardrail for 2 seconds*

This was the sound being made when the car was scraping itself against the guardrail: www.mediafire.com/listen/odyspw55tmz19p7/brakes+squeal.mp3

Drunk Pony: *Opens door which falls off*
Audience: *Laughing*
Drunk Pony: *Looking at damage* Oh shit!! *Looking at bodyshop* What a coincidence, a bodyshop that will fix my car. *Gets back into his car, and drives towards the bodyshop while getting in somepony else's way*
Ponies: *Stop their cars, and honk their horns*
Drunk Pony: *Drives slowly into bodyshop, and hits a car lift*
Audience: *Laughing*
Danielle: Something tells me that the Prius is here.
Mr. Beddler: *Runs from info room to shop, and sees the damage* What the hell is this?!
Drunk Pony: It's my car.
Audience: *Laughing*
Mr. Beddler: I know it's your car, but why did anda crash into the lift?
Drunk Pony: *Looking at his car* I crashed? When?
Audience: *Laughing*
Drunk Pony: My insurance company won't like hearing about this.
Mr. Beddler: Yeah, well OSHA ain't gonna be too happy to hear about what anda did to this lift.
Drunk Pony: That's a lift?
Audience: *Laughing*
Mr. Beddler: You're an idiot. Get your car out of here.
Drunk Pony: But I need somepony to take care of the hood.
Mr. Beddler: After what anda just did, the kap, hood is not the only thing in need of repairs. The front bumper, the headlights, even the front windshield. anda messed all of that up when anda crashed into this lift.
Drunk Pony: Hold up. Can anda repeat that? I was too busy thinking about getting drunk.
Audience: *Laughing*

After the drunk pony got back in his car, and drove away, Mr. Beddler went back to his employees.

Mr. Beddler: The Prius is gone.
Gary: What a relief.
Audience: *Laughing*
Mr. Beddler: But the car lift has been destroyed.
Cutlass Supreme: That was the only one we had!
Danielle: He died in the line of duty!
Audience: *Laughing*
Mr. Beddler: We'll get it fixed. Somehow.
Olive: You're giving us generic details again.
Audience: *Laughing, and clapping*
Mr. Beddler: *Becomes unconscious, and falls on floor*
Audience: *Laughing*

Up next, it's another Celestia skit.

Princess Celestia

Starring Celestia, Luna, Twilight, and Derpy as theirselves
Blaze as Jonathan (For this skit, he's bald.)
Cosmic pelangi as Chrysler (For this skit, he has a mustache.)
Mortomis as Bryan
Saten Twist as Timothy
Double Scoop as Skeletor
Master Sword as Harry
Sophie Shimmer as Alexis
Astrel Sky as Jenny

Lots of ponies were gathering at the main hall in Celestia's castle.

Bryan: *With Harry* There seems to be a lot of ponies that want to compete in this event.
Harry: *Carrying a glass of champagne* Nonsense. Absolute nonsense. The worst part is that I got invited.
Audience: *Laughing*
Harry: *Drinks champagne*
Twilight: *With Luna* Man, I'm gonna own everypony with my badass drivin' skills.
Luna: anda got a big mouth, but remember that I'm only here to fill in a position. *Whispers* I've heard from Jenny that Princess Celestia has been insulting everypony here. She says that she will shove red shells up everypony's plots.
Twilight: Man, Jenny must be goin' deaf. Dat job belongs to me.

Meanwhile in Celestia's office.

Derpy: You're groundbeef.
Audience: *Laughing*
Celestia: anda really think anda can make insults better then me? Get that trash out of here! Here's how it's done, behold! I'm going to shove my hoof so far up your ass, that anda will be puking out my horseshoe polish, into Europe.
Audience: *Laughing*

At Ponyville

Celestia Guard: *Driving truck with loudspeaker on the roof* Be prepared for Celestia's very first Super Kart Race, taking place at the Canterlot Raceway near her castle. Tickets are ten dollars each, and they can only be purchased online.
Applejack: That's bullshit! I'm too poor to have the internet!
Audience: *Laughing*

The selanjutnya day, Celestia, Derpy, Twilight, Luna, Jenny, Bryan, Harry, Chrysler, and Alexis were participating in the race. It was just like Mario Kart.

Audience: *Laughing*
Lakitu: *Holding a traffic light. The light turns red*
Racers: *Waiting for light to turn green*
Lakitu: *Changes light to yellow, and after five seconds, he changes it back to red*
Audience: *Laughing*
Celestia: Oh, for crying out loud! Start the race!
Lakitu: *Turns light green*

Everypony took off really fast past the starting line.. Except for Celestia. Her kart went five miles an hour, and broke down.

Audience: *Laughing*
Celestia: anda have got to be kidding.
Twilight: *In first place*
Luna: *About to pass Twilight, but slows down for the turn up ahead*
Twilight: *Turns right, and picks up a green shell* Who shall be my very first victim? *Shoots green shell backwards*
Derpy: *Looking at green shell* How pretty. *Drives into green shell*

Her kart went flying into a house where everypony was dancing.

Audience: *Laughing*
Harry: *Very drunk, and crashes into Chrysler*
Audience: *Laughing*
Celestia: *Trying to get her kart to start* This is a sack load of human shit.
Audience: *Laughing*
Celestia: Why must all the bad things happen to me?
Audience: *Laughing*
Twilight: *Dominating the race*
Jenny: *Drops bomb*
Luna: *Drives into bomb* I don't wanna get sent back to the moon!
Audience: *Laughing*
Jenny: *About to pass Twilight* Why don't anda taste my fury? Take this! *Crashes into warp pipe*
Audience: *Laughing*
Twilight: Nigga please.
Audience: *Cheering, and clapping*
Celestia: *Gets her kart started* What the hell took so long?! It's about time-
Twilight: Get out of the way! *Crashes into Celestia's kart*
Audience: *Laughing*
Alexis: *Gets a blue shell, and shoots it at Twilight*
Celestia: *Gets a star* Now anda will all taste my wrath! *Crashing into everypony*
Twilight: Man, your powers are good, but mine are better. *Gets a powerup, and is now driving a sports car*
Audience: *Laughing*
Twilight: Introducing the Twilight Mobile. *Gets a power up*
Car: Defense mechanisms, on.
Twilight: *Shoots misil, rudal at Alexis*
Alexis: *Gets hit oleh missile*
Twilight: Vengeance! Would anypony else like their plot to be kicked?
Derpy: Did everypony forget about me? *Driving a tank*
Audience: *Clapping*
Celestia: *Sees Derpy's tank* What's that?!!!?
Audience: *Laughing*
Celestia: This isn't a race anymore! It's a combination of screw ups, and insanity!
Twilight: *Drops pisang peel*
Derpy: Do anda really think that'll stop me? *Drives over pisang peel, and gets her tank to land on it's side*
Audience: *Laughing*

Twilight won the race.

Celestia: *Very angry* Derpy anda unreliable dumbass!!
Audience: *Laughing*

Two hours later.

Derpy: *Walks into Celestia's office, and sees Celestia at her desk* It appears Twilight Sparkle won the Super Celestia Kart. What is your opinion?
Celestia: You're actually gonna tell me that you're surprised oleh this? But let's talk about you! anda had a battletank! Idiot!
Audience: *Laughing*
Celestia: anda had an opportunity to win, but anda allowed yourself to get beaten oleh a Mary Sue. anda suck!
Audience: Don't be mean to Derpy!
Celestia: Go to timeout for your imcompetence! *Bangs on desk* TIMEOUT!
Audience: *Laughing*
Celestia: *Banging on desk* Timeout! Timeout!

Back on the block.

Master Sword: Well, this has been yet another good episode.
Tom: And we had three Toms. Me, Tom Selleck played oleh Saten Twist, and Tom Cruise, played oleh Blaze.
Master Sword: There were two other Tom's here?
Audience: *Laughing*
Tom: Yeah.
Master Sword: How come one of them wasn't Thomas The Tank Engine?!
Tom: He's on an island, and has no way to get here.
Audience: *Laughing*
Tom: And now, we're starting a new segment on this tampil that we like to call, brony of the month.
Master Sword: And for November's Brony of the month, we start it off with ladies first. The Brony of the bulan reward goes to Dragonaura15!
Audience: *Cheering*
Tom: She really deserves it. Dragonaura15 is one of the kindest pegasisters ever.
Master Sword: One of the kindest? She's nicer than anyone I know. She is the #1 pegasister ever! Congratulations girl!
Audience: *Clapping*

---

Welcome to the block, where a group of ponies that are friends live on the same block in Ponyville. And now for your hosts, Master Sword, and Tom Foolery.

Audience: *Cheering*
Master Sword & Tom: *Standing in front of a house*
Master Sword: Warner Brothers is at it again!
Audience: *Laughing*
Tom: What did they do this time?
Master Sword: They want to sue us for ripping off this TV tampil they created called F Troop, even though they gave us permission to do it.
Tom: What?
Master Sword: In one of our skits, The Story Of Corporal Agarn, it's based off of F Troop, and Warner Brothers created that show. They gave us permission to make that skit based off of their show. Now they're suing us for it.
Audience: Boo!!
Tom: Yeah, we know. Warner Brothers suck. Especially when it comes to Six Flags.
Audience: Yeah!
Tom: The lines are so long, that it takes half of the hari to go on one ride!
Audience: *Laughing*
Tom: What's today's crossover parody?
Master Sword: World Of Tank Engines. We're combining the populer videogame, World Of Tanks, with a populer kid's show, Thomas The Tank Engine.
Tom: That's gonna work out really well.
Audience: *Laughing*

World Of Tank Engines

Starring every single Thomas character as theirselves.

Also starring Heartsong as Kari
Saten Twist as Lieutenant Solo
Master Sword as Sargent Malone
Snow Wonder as Private Messinger
Blaze as Sargent McDonald
Mortomis as Corporal Cadillac
Daring Do as herself

Kari was standing oleh her tank at a farm, when Lieutenant Solo arrived.

Lieutenant Solo: Ma'am, we need your help with a war that could f**k up everyone's life.
Kari: But I thought mares weren't allowed to gabung the army. Unless, I came from a place called Paradise Island, and was a princess named Diana. (Wonder Woman Reference)
Audience: *Laughing*
Kari: I would be a mare with wonderful powers. Wonder Mare! That's what anda can call me!
Lieutenant Solo: Uhm, no.
Audience: *Laughing*
Lieutenant Solo: We want your tank-
Kari: My tank?! No! I worked hard to get thick armor, and a powerful gun on here.
Lieutenant Solo: anda didn't let me finish. I want that tank engine behind your farm.
Percy: I'm Percy the green engine!
Audience: *Laughing*

Percy was tanken

Audience: *Laughing*

I mean, taken! Taken to a military base with a lot of other tank engines.

Percy: Well, this is interesting.
Thomas: We're being assigned for a very special job.
Oliver: How special?
Thomas: *Excited* Very special!
Audience: *Laughing*
Lieutenant Solo: *Walking in front of tank engines*
Private Messinger: *Playing drums*
Lieutenant Solo: Shut up Private!
Private Messinger: *Stops playing drums*
Audience: *Laughing*
Lieutenant Solo: How many tank engines do we have here?
Percy: *Looking around* Uhm...
Audience: *Laughing*
Percy: Three?
Lieutenant Solo: No! We have ten! That's the perfect ammount for your special assignment.
Thomas: I thought it was a special job.
Lieutenant Solo: Don't interrupt me!
Audience: *Laughing*
Lieutenant Solo: anda are all going to have guns attached to you, and anda will, I repeat, anda will, destroy every diesel anda see! They are causing confusion, and delay!
Audience: *Laughing*
Percy: I had a fat controller who once berkata that.
Lieutenant Solo: SHUT UP!
Audience: *Laughing*

Meanwhile with Kari.

Kari: I can't let Percy get killed in this war that'll f**k everyone's lives up. Everyone? Everypony? Bah, who cares?
Audience: *Laughing*
Kari: I know what I'll do. I'll get my tank, and I'll save Percy. *Gets in her tank, and drives towards the first battle* Destination set to... Whatever battle Percy is fighting!
Audience: *Laughing*

Lieutenant Solo, and his soldiers were driving the tank engines along the line.

Thomas: I don't see anything.
Duck: This is pointless.
Oliver: Can we please go back to the Island Of Sodor?
Percy: How come no one berkata luckily no one was hurt yet?
Audience: *Laughing*
Lieutenant Solo: Hold it! Stop!

All the tank engines stopped.

Corporal Cadillac: See anything Lieutenant?
Lieutenant Solo: I see something that I need...
Corporal Cadillac: Yes?
Lieutenant Solo: To eat.
Audience: *Laughing*
Lieutenant Solo: *Walks out of Percy, and grabs an apel, apple from a tree* I've never seen one as bright as this one. *Eats apple*
Thomas: What about the diesels?
Lieutenant Solo: F**k 'em. I need to eat this apple.
Audience: *Laughing*
Diesel: I see a bunch of steamies! Kill them! *Shooting a machine gun*
Lieutenant Solo: Machine gun fire! Go back, and return fire! *Climbs into Percy, and goes backwards*

All the tank engines were going backwards, and shooting at the diesels.

Kari was still searching for Percy when this happened.

Kari: I should've found him oleh now, but no! That dumbass Lieutenant had to take him away from me.
Three Ponies: *Driving tier 4 tanks*
pony 1: It's a tier 7 tank! Hit it with everything anda got.
Kari: Oh crap.

The three tier 4 tanks blew up, and Daring Do arrived.

Daring Do: And now to finish this one off with my automatic grenade launcher that I mencuri from the enemy.
Kari: *Opens door to tank, and hits Daring Do without noticing* Whoever saved me from those three tanks, thank you!
Daring Do: Down here.
Kari: Daring Do! Stop whatever boring adventure you're doing, and come with me.
Daring Do: My adventures aren't boring!
Audience: *Laughing*
Kari: Okay, fine. They're very old.
Audience: *Laughing, and clapping*

Back to the tank engines.

Diesels: *Chasing tank engines*
Thomas: *Shoots meriam at Diesel*
Diesel: AH! *Comes off the rails* It's up to anda Salty!
Salty: It's up to me to do something right! Oh joy! This is like the story when-
Diesel: Don't tell us any of your sea tails yet!
Audience: *Laughing*
Salty: *Stops* Oh, anda don't want to hear any of my sea tails. This is like the story when I was about to tell one, but someone told me not to. He got sued oleh Warner Brothers.
Audience: *Laughing*
Diesel: They're getting away!
Salty: Oh, right! *Chasing the tank engines again*
Kari: *Arrives in her tank* Excuse me badly injured diesel that probably got shot oleh Percy. Have anda seen my tank engine Percy?
Audience: *Laughing*
Diesel: I'll tell anda where he is if anda get me to the nearest diesel works!
Kari: Forget it. *Pauses game, and turns it off* I prefer the original world of tanks. Talking trains don't deserve to be in a game full of violence.
Audience: *Laughing, and clapping*

The End

On the selanjutnya part of this episode, Saten Twist, and Aina go to watch a baseball game.

Theme Song: link

Master Sword: Come on Tom, let's go meet the others.
Tom: Right behind you.
Double Scoop: *Standing on jalan, street corner*
Aina: *Runs out of her house*
Sunny: Hey, wait for me. *Flying in the middle of the street*
Saten Twist: *Polishing his chain saw, but stops to go meet the others*
Pleiades: *Arrives at corner*
Mortomis: *Standing selanjutnya to Double Scoop*
Tom: lebih ponies!!
Snow Wonder: *Arrives in a brand new Corvette*
Cosmic Rainbow: *Flies from the clouds*
Heartsong: *Climbs out of a manhole*
Annie: *Arrives on a bicycle*
Blaze: *Flies out of a house window, and lands selanjutnya to Tom*
Sophie Shimmer: *Gets off of a slow moving bus*
Astrel Sky: *Appears out of nowhere with magic*
All: We live together on the block!
Audience: *Clapping*
Announcer: Okay, stop the song! We need to keep this thing rolling.
Audience: *Laughing*

Episode 5: Words That Have Nothing To Do With This Episode

Announcer: Okay. I'm going to say something that I have to say to all of our viewers. If anda laugh, I'm going to get angry. Let's give it a try. *Clears throat* On the block was filmed in front of a live audience.
Audience: *Laughing*
Announcer: Why are anda laughing?!?
Audience: anda can't film an article!
Announcer: I quit! *Leaves*

Saten Twist, and Aina were watching a baseball game. It just past the bottom of the 6th, and a special event was going to happen.

acak Pony: *Playing drums*
Ponies: *Watching a big stunt track*
Biker Pony: *Standing on puncak, atas of the stunt track*
Announcer: This is Evel Knievel Jr.
Audience: *Laughing*
Announcer: He will ride his motorbike down a very steep slope, starting at an elevation of 8,000 hooves.
Audience: *Laughing*
Announcer: Then, he shall go over three big loops, unless he wants to fall off, and die like his father.
Audience: *Laughing*
Announcer: Then, Evel Knievel Jr will jump off a ramp, and go over forty five buses.
Audience: *Cheering*
Aina: This oughta be fun.
Saten Twist: I hope he dies. I came here to watch baseball.
Audience: *Laughing*
Evel: *Rides down the 8,000 hoof slope*
Announcer: And he's going too fast, and fell off his motorbike. What a terrible hari for us all, but who cares? Let's get back to the baseball game.
Audience: *Laughing*
Saten Twist: I couldn't agree more.
Aina: You're sick.
Saten Twist: Not really. I feel very healthy.
Audience: *Laughing*

And now it's time for Celebrity Jeopardy.

Saten Twist: No it's not! We're not supposed to have another Celebrity Jeopardy skit until selanjutnya episode. Until then, I'm going home.

What about The Story Of Corporal Agarn?

Saten Twist: Come up with something else. *Leaves*
Aina: Maybe he really is feeling sick.
Audience: *Laughing*

In the selanjutnya part of this episode, it'll be Bodyshop Ponies.

Bodyshop Ponies

Starring Sophie Shimmer as Wheel Bearing
Heartsong as Danielle DeVito
Snow Wonder as Cutlass Supreme
Tom Foolery as Gary
Mortomis as Mr. Beddler
Pleiades as zaitun
Master Sword as Tim
and Annie as Edwina

No cars were in the shop. Mr. Beddler, and the others were not happy about it.

Wheel Bearing: Why are we here?
Mr. Beddler: Because somepony named.. *Looking at papaer* Saten Twist, doesn't want to do anything. We're on the air, because the skits he usually does are cancelled.
Audience: *Laughing*
Wheel Bearing: What do anda expect us to do?
Mr. Beddler: Clean the shop.
Employees: Ugh.
Edwina: We came here to fix cars. Not clean!
Audience: *Laughing*
Mr. Beddler: Get out there now!
Danielle: OKAY!!
Mr. Beddler: *Hides under his desk*
Audience: *Laughing*
Wheel Bearing: Alright everypony, let's go to work.

So they did. The garasi door was opened, and seven air hoses were plugged in. One for each pony. Except for Mr. Beddler. He was the boss, and didn't want to do anything. Besides, he was still scared of Danielle.

Audience: *Laughing*
Gary: *Cleaning dust off of a chair*
Tim: *Cleaning the wheel on a rolling chair that is upside down*
Gary: hey Tim. anda gave me an idea.
Tim: What is it?
Gary: *Sprays air hose at the side of a wheel on a rolling chair*
Audience: *Laughing*
Tim: *Acting like a child* Oh cool! *Sprays his hose the same direction as Tom's and makes the wheels spin faster* They're all moving in a circle.
Gary: We need lebih air hoses, and this thing might take off like an airplane.
Audience: *Laughing*
Tim: It does sound like an airplane.
Mr. Beddler: *Hears noise* What is that? *Walking towards Tim, and Gary*
Tim: Here comes Mr. Beddler.
Gary: *Sprays air hose against the wheels, and makes them stop spinning*
Mr. Beddler: What are anda two doing?
Gary: What?
Mr. Beddler: I asked anda a question.
Gary: Where?
Audience: *Laughing*
Mr. Beddler: Stop akting like Vinnie Barbarino from that Welcome Back Potter skit anda did, and answer my question!
Audience: *Laughing, and cheering*
Gary: When?
Audience: *Clapping*
Mr. Beddler: Tim, anda better tell me what that noise was.
Tim: It was an airplane. Didn't anda hear it pass us?
Mr. Beddler: *Thinking* Yeah. I thought anda two were up to no good. I heard your air hoses at the time, and thought anda were making some strange noise.
Audience: *Laughing*
Gary: Thanks for making some stupid assumption boss.
Audience: *Laughing*
Tim: Yeah. anda told us to clean this shop, and that's what we're doing.
Mr. Beddler: Forgive me. Get back to work. *Walks away*
Gary: *Quietly laughs* That was close.
Tim: I like how anda were just asking him questions. What? Where? When?
Audience: *Clapping*

pelangi Dashed

Starring everypony as theirselves.

Narrator: One lovely morning, pelangi Dashed arrived at Sugarcube Corner.
Pinkie Pie: Hi pelangi Dash.
pelangi Dash: Shut the f**k up.
Audience: *Laughing*
pelangi Dash: Can't anda see I got a hangover? My head feels like a bomb is about to go off.
Twilight Sparkle: My head is a bomb.
Audience: *Laughing*
Twilight Sparkle: Are anda going to help me learn how to clear clouds?
pelangi Dash: Forget that, I need a drink.

So she walked out of Sugarcube Corner, and saw an over sized champagne bottle that said...

pelangi Dash: Spitfire. I'm haluci- halizit, hallucinating again.
Narrator: berkata pelangi Dash, with great difficulty.
Audience: *Laughing*
pelangi Dash: *Walks towards a water trough* Fill me up Mr. Water Trough.
Narrator: berkata pelangi Dash without moving her lips.
Audience: *Laughing*
Water Trough: *Gets filled with brandy* That's your share pelangi Dash.
Narrator: berkata the water trough.
Water Trough: Unless anda want to share some of Twilight Sparkle's.
Audience: *Laughing*
pelangi Dash: *Drinking brandy*
Audience: *Laughing* Drink it up!!
pelangi Dash: Well, I'm off to The Ztables.
Audience: *Laughing*
Narrator: pelangi Dash looked meneruskan, ke depan to her daily visit to the Stables. Even if it was a silly name for a bar. As she got there, pelangi Dash saw Rachel, the grey unicorn.
Rachel: Hello my little pony.
Audience: *Laughing*
pelangi Dash: There's no need to advertise.
Audience: *Laughing*
Narrator: berkata pelangi Dash, who was actually taller then Rachel.

Just then, Princess Celestia walked into the bar.

Princess Celestia: What's all this horsing around?
Audience: *Laughing*
pelangi Dash: Mind your own business anda celestial princess.
Audience: *Laughing*
Narrator: And without hesitating, pelangi Dash punched Celestia once, really hard in the neck, killing her instantly.
Audience: *Laughing*
Narrator: The princess was about to fart at the time.
Audience: *Laughing*

Two stallions walked into the bar, and were selanjutnya to pelangi Dash, and Rachel.

pelangi Dash: *Sticks out her tongue* Awesome. These two have something really cool between their back legs.
Audience: *Laughing*
Rachel: Mmh, I don't fancy mine much.
pelangi Dash: Enough with British words, and sayings.
Narrator: The four ponies left the bar.
pelangi Dash: Wanna come over to my place? The four of us can hang out.

The doors on the bar close, and anda cannot see them. There's a crashing sound, and anda can hear tires skidding.

pelangi Dash: *Laying on puncak, atas of a stallion* I saved us all from a reckless driver.
Rachel: Get off him.
Narrator: So Rachel got a bucket of water out of nowhere, and threw it onto pelangi Dash.
Audience: *Laughing*

A police car heads towards pelangi Dash.

pelangi Dash: *Smoking a cigarette* Uh oh. Here comes P.C. Pullman.
Officer Pullman: What's going on pelangi Dash? Have anda been drinking?

P.C. Pullman turned out to be an oversized lego policeman.

Audience: *Laughing*
pelangi Dash: N-no sir.
Narrator: And she soon threw up all over the policeman. It all turned out well in the end. Rachel went to Manehattan to become a prostitute.
Audience: *Laughing*
Narrator: And pelangi Dash was sent to a doctor about her drinking problem, but ended up being executed for killing Princess Celestia.
Audience: *Laughing*

On the selanjutnya part of this episode, it's a classroom skit.

The Classroom

Starring Snow Wonder as Ms. Schultz
Tom as Gary
Astrel Sky as Maria
Sunny as herself
Pleiades as Brianna
Double Scoop as James
Aina as Lauren

Everypony in Ms. Schultz's class was bored. They had to write down a paragraph about the importance of geometry.

Gary: *Chewing eraser on pencil*
James: *Sleeping, and thinking about ice cream*
Sunny: What is this? English class?
Audience: *Laughing*
Sunny: We're supposed to be learning about math here!
Audience: *Laughing*
Ms. Schultz: anda are. If anda keep menulis that essay, anda will.
Brianna: Ms. Schultz, Sunny has a very good point. Why are we doing something related to English class, when we are supposed to be doing math problems?
Lauren: Better yet, why do we learn about these things with somepony that insults anda 24/7?
Gary: That's what I've been doing to you?
Audience: *Laughing*
Lauren: What? anda didn't know that calling somepony an idiot was insulting?
Audience: *Laughing*
Gary: I was just messing around. I didn't mean it.
Lauren: Let's not forget yesterday, when anda berkata I smelled like shit. I told anda I got offended, and anda said, *Talking like Gary* Please, be offended.
Audience: *Laughing*
Maria: That was a terrible impression of Gary.
Gary: What about me?
Audience: *Laughing*
Maria: This is how to do it properly. *Clears her throat, and sounds exactly like Tom Hanks* Lauren, anda smell like shit.
Audience: *Laughing*
Gary: That didn't sound anything like me either.
Lauren: Ms. Schultz, do anda see who I have to put up with over here?
Ms. Schultz: Get better perfume.
Audience: *Laughing*

Saten Twist walks in the classroom.

Audience: *Clapping*
Saten Twist: I didn't do anything yet. Hold your applause until I actually do something.
Audience: *Laughing*
Ms. Schultz: Why are anda here?
Saten Twist: I'm feeling better after being in that baseball game with *Sees Lauren* Aina, you're here too?
Lauren: Aina? Who's that?
Audience: *Laughing*
Gary: Twist-
Saten Twist: Don't call me that. There's a very bad pony with that name, and my name is Saten Twist.
Audience: *Laughing*
Gary: Whatever. Aren't anda supposed to be in the Celestia skit in the selanjutnya part of this episode?
Saten Twist: No, we're doing a musical instead.
James: Hah! Gaaaaaaay!!
Audience: *Laughing*
Ms. Schultz: James, what did I tell anda about saying that word?
James: Your mother.
Audience: *Laughing*
Saten Twist: Before I go, *Looks at James* Your mother is so fat, that she needs a derek, crane to go upstairs. *Walks away*
Audience: *Laughing*
James: A your mother joke?
Gary: Was he for real?
James: I heard better insults from my baby brother.
Audience: *Laughing*

Saten Twist was with Tom, and Master Sword.

Tom: Well, we're glad you're feeling better.
Saten Twist: Thanks anda guys.
Master Sword: What caused anda to feel sick anyway?
Saten Twist: Being too far away from my chainsaw.
Audience: *Laughing*

Just then, Sunny, and Heartsong arrived in a time machine.

Sunny: Hey, check this out!
Tom: Where did anda find that?
Heartsong: The junkyard. The owner berkata it didn't work.
Audience: *Laughing*
Master Sword: He must've been one stupid owner.
Sunny: atau he just didn't want a time machine. So we took it off his hooves for him.
Tom: So where do anda plan to go with that thing?
Heartsong: 1966! *Hits button*

Everypony appeared selanjutnya to each other.

Snow Wonder: How did this happen?
Heartsong: I pushed a button.
Tom: She wants to know how we all ended up here!
Audience: *Laughing*
Heartsong: I know.
Annie: There's only one thing I can think of for us to do in this situation.
Master Sword: Go back to the tahun 2014?
Annie: No! Go to different places, and dance to music!
Audience: *Laughing*

Song: link

Tom: What's taking so long for this song to start? *Hears the song* There we go.
Audience: *Laughing*
Heartsong: *Dancing in a building*
Snow Wonder: *Dancing at a park*
Saten Twist: *Dancing in the middle of an intersection* I don't care if I die!
Audience: *Laughing*
Aina: *Dancing on puncak, atas of a train*
Train Ponies: *Dancing on the ground oleh the train*
Annie: *Dancing at Alcatraz*
Blaze: *Dancing on the beach* Why are we dancing in so many different places?!
Audience: *Laughing*
Tom: *Dancing in front of Sugarcube Corner*
Mortomis: *Dancing on Manehattan Bridge* How come he's in Ponyville, and I'm in Manehattan?
Audience: *Laughing*
Saten Twist: *Dances at the intersection*
Ponies: *Passing oleh in cars*
Astrel Sky: *Dancing on puncak, atas of a pyramid* How am I going to get down?
Audience: *Laughing*
Sophie Shimmer: *Dancing in London* hey british ponies, who wants to dance with me?
British Ponies: *Dancing with Sophie Shimmer*
Sophie Shimmer: *Continues dancing* Bloody hell. There's a lot of ponies here.
Audience: *Laughing*
Blaze: *Dancing in Miami*
Master Sword: *Dancing in Las Pegasus*
pony in car: Queer! *Drives away*
Master Sword: And I cinta anda too.
Audience: *Laughing*
Pleiades: *Dancing at an airport*
Pilot: *Crashes a plane in a building behind Pleiades*
Pleiades: *Continues dancing*
Audience: *Laughing*
Double Scoop: *Dancing oleh an ice cream store* Come on, anda knew I was gonna end up here.
Audience: *Laughing*
Aina: *Dancing on train. She feels it slowly moving* Is it moving? Should I get off?
Director: Stay on there, atau you're fired.
Audience: *Laughing*
Saten Twist: *Still dancing at the intersection, and sees a cement truck pass him* They had those back then?!
Audience: *Laughing*
Pleiades: *Dancing at the airport*
Ponies: *Running from building on fire*
Pleiades: Nopony wants to dance with me? Oh well.
Audience: *Laughing*
Heartsong: Okay, that's enough. *Goes to time machine, and goes back to 2014*

Everypony ended up back on the block with Heartsong.

Tom: Seriously. How do anda end up having us end up where anda go in that thing, when we're no where near you?
Audience: *Laughing*
Heartsong: Luck I guess.
Master Sword: And that's all the time we have for now. I'm Master Sword.
Tom: And I'm Tom Foolery.
Master Sword: See anda in the selanjutnya episode of.
Everypony: On The Block!
Audience: *Clapping*

The End

Sean: Wait, we had no scene to put in between those two episodes?
Sean The Hedgehog: Guess not. Whatever. We'll be back at 8:30 with My Little Pornstar, and Adventures of Thomas & Friends. See anda later.
added by NocturnalMirage
posted by Seanthehedgehog
Bill welded some metal pieces onto the perahu to turn it into a machine gun nest for May.

Bill: *Looking at May from the back of the boat* Now if any cops in Salt Lake shoot at you, api warning shots. If anda have to shoot them, only shoot their weapons so they can't return fire. I don't want anda to kill any officers.
May: I understand.
Bill: Remember, this is only for Salt Lake City, so if anyone follows us outside of that town, feel free to blow their heads off. I have to make a call. *Walks into the welding station, and goes to a phone*

The clock behind him berkata 2:53

Gordon: *At his meja tulis, meja in the...
continue reading...
posted by Seanthehedgehog
Bill, and May were now walking alongside an isolated road. There was nothing but desert surrounding them.

May: Instead of getting me to Salt Lake City, anda managed to get me to the middle of nowhere.
Bill: *Turns around, and points at what's coming towards them* What do anda see there?
May: It looks like a boat. Do anda see that?
Bill: Yeah. We're not having a mirage.

The perahu was on a trailer being towed oleh a truck.

Bill & May: *Jump onto the trailer, and rest in the boat*
Bill: Now we'll get out from the middle of nowhere, and back into civilization.
May: Where does this road even go?
Bill: I don't...
continue reading...
posted by Seanthehedgehog
 The following is a SeanTheHedgehog Production
The following is a SeanTheHedgehog Production
On May 27, 2016, a war was started oleh a Hungarian named Gergely Szórád. He started this war on a website on the internet called Fanpop. He replaced an icon, using a picture that had Starlight Glimmer in it. Gergely also threatened to kill anyone that opposed the new icon he created. This angered millions, and membagi, split the My Little pony fandom into two. The S.G. Bronies, (the bad guys), and the Anti S.G. Bronies, (the good guys.) This war also created a new law in April 12, 2018, all forms of entertainment were made illegal. This law was a gateway to making easy money on the internet, oleh upload
continue reading...
added by Seanthehedgehog
The original theme
video
hedgehog
the
sean
musik
sean the hedgehog
movie
added by Seanthehedgehog
No derailments!
video
hedgehog
the
sean
musik
sean the hedgehog
added by Seanthehedgehog
Do not take sports cars for off road joyrides.
video
hedgehog
the
sean
musik
car chase
chips
sean the hedgehog
It's a membaca 6-chime whistle. The best whistle ever.
video
hedgehog
the
sean
trains
sean the hedgehog
added by Seanthehedgehog
video
hedgehog
the
sean
musik
sean the hedgehog
video
hedgehog
the
sean
musik
sean the hedgehog
added by Seanthehedgehog
Source: Me
added by Seanthehedgehog
Don't tell anyone. It's a secret scheme that must be successful.
video
hedgehog
the
sean
musik
sean the hedgehog
spageti, spaghetti
video
hedgehog
the
sean
musik
sean the hedgehog
video
hedgehog
the
sean
sean the hedgehog
added by NocturnalMirage
added by Seanthehedgehog
Could anda tampil me how to make catacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacata?
video
hedgehog
the
sean
musik
sean the hedgehog
catacatacatacatacatacatacatacatacatacatacatacatacatacatacata
added by Seanthehedgehog
Tom Hanks is also here.
video
hedgehog
the
sean
musik
sean the hedgehog
posted by Seanthehedgehog
Harry stopped his car just in front of the Cape Harbor Hotel Inn.

Alan: *Gets out of the car* What time do anda think you'll be back?
Harry: About five minutes. *Drives away*
Alan: *Walks to his hotel room, taking his key out of his pocket*

He got to the puncak, atas of the stairs, took a right, and saw Camryn standing in front of his room.

Alan: Camryn?
Camryn: I just finished cleaning your room.
Alan: I didn't even get to go in yet. *Comes towards Camryn* anda didn't have to clean it.
Camryn: It was a real mess in there.
Alan: Why don't anda come with me to the beach? My partner is coming back soon, and I'd like...
continue reading...
added by Seanthehedgehog
Source: me